7 releases

new 0.3.1 Nov 6, 2024
0.3.0 Nov 4, 2024
0.2.2 Oct 11, 2024
0.1.2 Sep 26, 2024

#74 in Biology

Download history 406/week @ 2024-09-25 53/week @ 2024-10-02 358/week @ 2024-10-09 27/week @ 2024-10-16 92/week @ 2024-10-30

477 downloads per month

BSD-3-Clause

82KB
1.5K SLoC

Parallel Construction of Suffix Arrays in Rust

This is the CLI tool for creating a suffix array using libsufr.

Usage

Use -h|--help to view documentation:

$ sufr --help
Parallel Construction of Suffix Arrays in Rust

Usage: sufr [OPTIONS] [COMMAND]

Commands:
  create   Create suffix array
  check    Check correctness of suffix array/LCP
  extract  Read suffix array and extract sequences
  search   Search a suffix array
  help     Print this message or the help of the given subcommand(s)

Options:
  -l, --log <LOG>            Log level [possible values: info, debug]
      --log-file <LOG_FILE>  Log file
  -h, --help                 Print help
  -V, --version              Print version

Create a Suffix Array

Use the create action to generate the sorted suffix/LCP arrays from FASTA/Q input:

$ sufr create -h
Create suffix array

Usage: sufr create [OPTIONS] <INPUT>

Arguments:
  <INPUT>  Input file

Options:
  -n, --num-partitions <NUM_PARTS>  Subproblem count [default: 16]
  -m, --max-context <CONTEXT>       Max context
  -t, --threads <THREADS>           Number of threads
  -o, --output <OUTPUT>             Output file
  -d, --dna                         Input is DNA, ignore sequences starting with 'N'
  -h, --help                        Print help
  -V, --version                     Print version

For example, using the human T2T chr1 (248M bp):

/usr/bin/time -l sufr --log info create --dna -n 64 chr1.fa
[2024-10-11T20:24:20Z INFO  sufr] Using 8 threads
[2024-10-11T20:24:20Z INFO  sufr] Read raw input of len 248,387,329 in 258.480792ms
[2024-10-11T20:24:20Z INFO  libsufr] Selected 639 pivots in 535.25µs
[2024-10-11T20:24:25Z INFO  libsufr] Wrote unsorted partitions in 5.393286208s
[2024-10-11T20:24:41Z INFO  libsufr] Sorted 64 partitions (avg 3881052) in 15.999000708s
[2024-10-11T20:24:43Z INFO  sufr] Wrote 2,235,486,019 bytes to 'chr1.sufr' in 1.407683834s
[2024-10-11T20:24:43Z INFO  sufr] Total time: 23.106772459s
       23.32 real       143.65 user        10.12 sys
          1177272320  maximum resident set size
                   0  average shared memory size
                   0  average unshared data size
                   0  average unshared stack size
              245897  page reclaims
                   4  page faults
                   0  swaps
                   0  block input operations
                   0  block output operations
                   0  messages sent
                   0  messages received
                   0  signals received
                4911  voluntary context switches
             1386865  involuntary context switches
        794098220487  instructions retired
        497221392750  cycles elapsed
           966626944  peak memory footprint

Check Output

The resulting .sufr file is a binary-encoded representation of the suffix/LCP arrays and the original sequence and other metadata from the create action. Use the check action to verify that the suffix array is correctly sorted and that the LCP values are accurate:

$ sufr check -h
Check correctness of suffix array/LCP

Usage: sufr check [OPTIONS] <SUFR>

Arguments:
  <SUFR>  Sufr file

Options:
  -v, --verbose  List errors
  -h, --help     Print help
  -V, --version  Print version

For example:

$ sufr check chr1.sufr
Checked 248,387,329 suffixes, found 0 errors in suffix array.
Finished checking in 4.4269505s.

Extract Suffixes

The extract action will display a range of suffixes from the .sufr file:

$ sufr extract --help
Read suffix array and extract sequences

Usage: sufr extract [OPTIONS] <SUFR>

Arguments:
  <SUFR>  Sufr file

Options:
  -m, --max-len <MAX>      Maximum length of sequence
  -e, --extract <EXTRACT>  Extract positions [default: 1]
  -n, --number             Number output
  -o, --output <OUTPUT>    Output
  -h, --help               Print help
  -V, --version            Print version

For example, to select the one-millionth suffix from chr1 with a maximum length of 30 bp:

$ sufr extract -n -e 1000000 -m 30 chr1.sufr
  16003693: AAAAAGAAAACACATCATGTAACTGACTGT

The search action will look for a query string in the .sufr file:

$ sufr search --help
Search a suffix array

Usage: sufr search <QUERY> <SUFR>

Arguments:
  <QUERY>  Query
  <SUFR>   Sufr file

Options:
  -h, --help     Print help
  -V, --version  Print version

For instance:

$ sufr search AAAAAGAAAACACATCATGTAACTGACTGT chr1.sufr
Query 'AAAAAGAAAACACATCATGTAACTGACTGT' found in range 1000000..1000001 in 413.042µs

Authors

Dependencies

~11–22MB
~321K SLoC